Modulation of Peroxisome Proliferator-Activated Receptor Activity Affects Neural Cell Adhesion Molecule and Polysialyltransferase ST8SiaIV Induction by Teratogenic Valproic Acid Analogs in F9 Cell Differentiation

It has been suggested that the teratogenic effects of the antiepileptic drug valproic acid (VPA) is reflected in vitro by the differentiation of F9 cells, activation of peroxisome proliferatoractivated receptor (PPAR ), and inhibition of histone deacetylases (HDACs). The aim of this study was to identify genes involved in the differentiation of F9 cells induced by VPA, teratogenic VPA derivatives, or the HDAC inhibitor trichostatin A (TSA) and to characterize the role of PPAR . Treatment of the cells with teratogenic VPA derivatives or TSA induced differentiation of F9 cells, mRNA, and protein expression of the neural cell adhesion molecule (NCAM) as well as activated the 5 flanking region of the NCAM promoter, whereas nonteratogenic VPA derivatives had no effect at all. The polysialyltransferases [ST8SiaIV (PST1) and ST8SiaII] are responsible for the addition of polysialic acid (PSA) to NCAM. The mRNA expression of PST1 was highly induced by only teratogenic VPA derivatives and TSA. As shown by fluorescence-activated cell sorting analysis the level of PSA was higher after treatment of F9 cells with teratogenic VPA derivatives. It is interesting that overexpression of the PPAR but not PPAR or PPAR in F9 cells resulted in higher induction of NCAM mRNA and protein expression and of PST1 mRNA expression (and a higher PSA level) than in mock-transfected F9 cells. Furthermore, repression of PPAR activity in F9 cells inhibited these effects. We conclude that NCAM and PST1 are molecular markers in F9 cell differentiation caused by treatment with teratogenic VPA compounds or TSA and suggest that in addition to HDAC inhibition PPAR is involved in the signaling pathway. Valproic acid (2-n-propylpentanoic acid; VPA) has a remarkable antiepileptic activity, but it is teratogenic in humans and in mice when given during early organogenesis of the embryo (Nau et al., 1991). The mechanism of interference of VPA with embryonic development is unknown. In humans, VPA can cause spina bifida, a posterior neural tube defect. In the mouse, the predominant neural tube defect after single VPA injection on day 8 of gestation is exencephaly, an anterior neural tube defect. Repeated treatment on day 9 of gestation induces posterior neural tube defects (spina bifida aperta and occulta) (Ehlers et al., 1992). In the search for new drugs with selective anticonvulsant activities and less toxicity, numerous derivatives and various metabolites of VPA have been investigated and found to exert anticonvulsant activity in rodents (Nau et al., 1991; Ehlers et al., 1992). It has been shown that the teratogenic effects are caused by VPA itself, not one of its metabolites (Ehlers et al., 1992). The teratogenic effects in vivo and in vitro depend on structural requirements (Nau et al., 1991; Bojic et al., 1996; Lampen et al., 1999). In vitro only teratogenic VPA derivatives induce cell differentiation of embryonic F9 stem cells (Lampen et al., This study was supported financially by the Deutsche Forschungsgemeinschaft (LA: 1177/5-3), BfR-ZEBET (Berlin), and EU-RTN2-2001-00370. Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org. doi:10.1124/mol.104.009340. ABBREVIATIONS: VPA, valproic acid; PPAR, peroxisomal proliferator-activated receptor; HDAC, histone deacetylase; TSA, trichostatin A; NCAM, neural cell adhesion molecule; PSA, polysialic acid; STX, polysialyltransferase ST8SiaII; PST1, polysialyltransferase ST8SiaIV; cPGI, carbaprostacyclin; AP-2, activator protein-2; PBS, phosphate-buffered saline; DTT, dithiothreitol; RT-PCR, reverse transcription-polymerase chain reaction; RSV, Rous sarcoma virus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; bp, base pair(s); PCR, polymerase chain reaction; RT, reverse transcription; FACS, fluorescence-activated cell sorting; ANOVA, analysis of variance; butyl-4-yn-VPA, 2-(2-propinyl)-hexanoic acid; pentyl-4-ynVPA, 2-(2-propinyl)-heptanoic acid; hexyl-4-yn-VPA, 2-(2-propinyl)-octanoic acid; heptyl-4-yn-VPA, 2-(2-propinyl)-nonanoic acid; isobutyl-4-ynVPA, 2-(2-methylpropyl)-4-pentynoic acid; 4-yn-VPA, 2-n-propyl-4-pentynoic acid; E-2-en-VPA, 2-n-propyl-2-pentenoic acid; 4-en-VPA, 2-npropyl-4-pentenoic acid; ethyl-4-yn-VPA, 2-ethyl-4-pentynoic acid. 0026-895X/05/6801-193–203$20.00 MOLECULAR PHARMACOLOGY Vol. 68, No. 1 Copyright © 2005 The American Society for Pharmacology and Experimental Therapeutics 9340/3039341 Mol Pharmacol 68:193–203, 2005 Printed in U.S.A. 193 at A PE T Jornals on D ecem er 9, 2017 m oharm .aspeurnals.org D ow nladed from 1999), which is believed to reflect early events in the embryonal development (Alonso et al., 1991; Werling et al., 2001), whereas nonteratogenic VPA derivatives did not induce F9 cell differentiation. VPA has been shown to interact with an intracellular receptor, the peroxisome proliferator-activated receptor (PPAR ; Lampen et al., 1999, 2001a; Werling et al., 2001). Three PPAR isotypes have been identified: , (also called and NUC1), and . Structure-activity investigations have shown that only teratogenic VPA derivatives activate PPAR , whereas nonteratogenic compounds had no effect at all (Lampen et al., 2001a). Acetylation and deacetylation of histones play significant roles in the regulation of gene transcription in many cells. There are two classes of enzymes involved in the acetylation state of histones, histone acetyl transferases, and histone deacetylases (HDACs). It was recently shown that VPA inhibits HDAC activity in F9 teratocarcinoma cells and that PPAR is derepressed by HDAC inhibition (Gottlicher et al., 2001; Phiel et al., 2001). Trichostatin (TSA) is an anticancer compound and a well characterized HDAC inhibitor able to induce cell differentiation. It is interesting that TSA is also a teratogenic compound that induces neural tube defects very similar to those induced by VPA (Svensson et al., 1998; Phiel et al., 2001), suggesting that VPA and TSA may act in a similar manner. The neural cell adhesion molecule (NCAM) plays a major role in the development and plasticity of the nervous system (Rutishauser et al., 1988). Three different isoforms of NCAM that are encoded by a single-copy gene and generated via alternative RNA splicing as well polyadenylation, and posttranslational modifications of glycosylation, sulfation, and phosphorylation have been described previously (Goridis and Brunet, 1992). Potential inhibition effects of VPA on tumor metastasis are currently under investigation, and some in vitro and in vivo studies indicate a close relationship not only between tumor metastasis and NCAM expression but also between neuritogenesis and NCAM expression. VPA is reported to increase membranous expression of NCAM in human glioma cell lines as well as in Ntera-2 cells (Cinatl et al., 1996; Skladchikova et al., 1998), but it is not clear how VPA controls NCAM. Polysialic acid (PSA) is a unique polysaccharide consisting of -2,8-linked sialic acid residues attached to N-glycosylation sites on the fifth immunoglobulin-like domain of NCAM (Muhlenhoff et al., 1998). PSA modifies the adhesive potential of NCAM. Because of its steric properties, PSA attenuates cell-cell adhesion and is generally considered a promoter of neural plasticity, allowing cell movements and changes in cell interactions (Rutishauser and Landmesser, 1996). Two enzymes are responsible for the addition of oligosaccharides to the NCAM protein: the two closely related polysialyltransferases ST8SiaII (STX) and ST8SiaIV (PST1). To the best of our knowledge, it is not known whether VPA, VPA derivatives, or TSA has an effect on PST1 or STX. The present study was undertaken to identify genes involved in the VPAinduced differentiation of F9 cells as valuable model for early events in the embryonal development and to compare the effects with treatment of the cells with a typical HDAC inhibitor (TSA). In addition, we analyzed the role of the PPAR activity in expression of NCAM and PST1. Materials and Methods Cell Culture and Reagents. Mouse F9 cells were obtained from the American Type Culture Collection (Manassas, VA) and were maintained in Ham’s F-12/Dulbecco’s modified Eagle’s medium (Invitrogen, Karlsruhe, Germany) medium supplemented with 2 mM glutamine, 0.0012% (w/v) mercaptoethanol, and 10% fetal bovine serum at 37°C in a humidified atmosphere of 5% CO2 in air. The carbaprostacyclin (cPGI) was obtained from Cayman Chemical (Ann Arbor, MI). Plasmids. The pBV-NCAM expression vector contains the NCAM promoter (Barton et al., 1990) and was a generous gift from Prof. C. H. Barton (Department of Biochemistry and Molecular Biology, University of Southampton, Southampton, UK). It is interesting that, according to the Web-based software tool ConSite (http://www. phylofoot.org/consite), the NCAM promoter contains responsive elements of c-fos and AP-2. These two genes have been recently identified as markers of VPA-induced F9 cell differentiation (Werling et al., 2001). The pGL2-PST2 plasmid contains the ST8SiaIV promoter (Eckhardt and Gerardy-Schahn, 1998) and was a generous gift from Prof. R. Gerardy-Schahn (Medizinische Hochschule Hannover). It is interesting that this promoter also contains, according to ConSite, responsive elements of c-fos and AP-2. The pSG5-mPPAR and the pSG5-mPPAR expression vector contains mouse PPAR or mouse PPAR and were kindly provided by Prof. G. Perdew (Penn State University, University Park, PA) and described in Sumanasekera et al. (2003). The pcDNA3-PPAR expression plasmid and the pcDNA3PPAR E411P mutant cDNA of PPAR were derived from pSG5FAAR (Amri et al., 1995) as described in Bastie et al. (2000). The dominant-negative PPAR was generated by substitution of a glutamate residue by a proline in the loop preceding the AF-2 domain. Receptors mutated in or near the AF-2 region are inactive and neither release corepressors nor interact with coactivators. Synthesis of VPA Derivatives. VPA was obtained from Sigma Chemie (Deisenhofen, Germany). E-2-en-VPA was obtained from Desitin (Hamburg, Germany). The other VPA derivatives and the pure enantiomers (R)and (S)-4-yn-VPA were synthesized as described by Hauck and Nau (1992) and Bojic et al. (1996). Transfection and Drug Treatment. Gene transfer was carried out using the calcium phosphate precipitation technique following standard protocols. The final DNA content was 0.2 g of one expression plasmid (pBV-NCAM or GL2-PST2) per well in 1 ml of medium. Six hours after transfection, the medium was changed, cells were washed with phosphate-buffered saline (PBS), and new medium containing the test compounds was added. After 24 h of exposure, the medium was removed, cells were washed twice in PBS without Ca and Mg , and harvested in 200 l of lysis buffer (0.1 M Tris-acetate, pH 7.5, 2 mM EDTA, and 1% Triton X-100). For measurement of luciferase activity, the samples were pipetted into transparent reading tubes and transferred to a luminometer (Lumat LB9507; Berthold Technologies, Bad Wildbad, Germany). There, the samples were mixed automatically with 100 l of luciferin-containing buffer (20 nmol/test) and 300 l of assay buffer (25 mM glycylglycerine, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, and 2 mM ATP, pH 7.8). We used a cytomegalovirus-Gal plasmid as a control for transfection efficiencies and to standardize luciferase activities. To study transfection of F9 cells with pSG5-mPPAR , pSG5mPPAR , pcDNA3-mock, pcDNA3-PPAR , or pcDNA3-PPAR E411P, overexpression of F9 cells or repression of PPAR was determined by RT-PCR and Western blotting. Total cell extracts were prepared from the cells in a buffer containing 50 mM Tris, pH 7.4, 250 mM NaCl, 5 mM EDTA, 1 mM vanadate, 0.5 mM phenylmethylsulfonyl fluoride, and 0.1% Nonidet P-40. The extracts were separated on 10% polyacrylamide SDS gels and blotted to nitrocellulose membranes. PPAR and PPAR E411 mutant proteins were detected using a polyclonal antiserum raised against the A/B domain of mouse PPAR ; this antiserum recognizes native and mutated PPAR . Immunodetection was performed by chemiluminescence using an enhanced chemiluminescence 194 Lampen et al. at A PE T Jornals on D ecem er 9, 2017 m oharm .aspeurnals.org D ow nladed from advanced reagent (Amersham Biosciences Inc., Braunschweig, Germany). Transfection of F9 Cells and Treatment with Indomethacin. Expression vector (RSV-Luc), transfection, and reporter gene assay were described previously (Lampen et al., 1999). It is interesting that the RSV-promoter contains, according to ConSite, responsive elements of c-fos and AP-2. The concentration of dimethyl sulfoxide in the cultures did not exceed 0.5%. Exposure was made in triplicate, and for each assay a positive control containing 1 mM VPA as well a negative control containing 1 mM 2-en-VPA (Lampen et al., 1999) was measured. This concentration of VPA was used in all experiments to ensure the comparison with known data in the literature. Induction of RSV-Luc by 1 mM VPA was used to normalize the interassay variabilities. After 20 h of exposure, the medium was removed, cells were washed twice in PBS without Ca and Mg , and harvested in 200 l of lysis buffer (0.1 M Tris-acetate, pH 7.5, 2 mM EDTA, and 1% Triton X-100). For measurement of luciferase activity, the samples were pipetted into transparent reading tubes and transferred to a luminometer (Lumat LB9507; Berthold Technologies) and assayed as described previously (Lampen et al., 1999). Total RNA Preparation. Total RNA was extracted from F9 cells as described in Lampen et al. (1999). In addition to absorbance measurements, the concentration of RNA was verified on agarose gel colored with ethidium bromide. The amount of RNA was quantified using Ribogreen kit (MobiTec, Göttingen, Germany) for the competitive RT-PCR. Oligonucleotides Used for Amplifications. The competitive quantitative RT-PCR was performed as described in Aubeouf et al. (1997). The various primers for the construction of internal standards and for competitive quantitative RT-PCR were derived from the mouse cDNA-sequences of NCAM, PST1, or GAPDH. If possible, they were designed to span a product that consists of two exons. Construction and Use of the Competitors. We used PCR to generate an internal deletion within the target cDNA sequence of each gene selected for quantification. We designed four primers (P1–P4) spanning two products (A and B) with a deletion between 50 and 80 bp. The reversed primer P2 of fragment A and the forward primer P3 of the fragment B contained a linker of 22 bp complementary to each other. After the PCR of fragments A and B, these two products were cleaned using PCR purification kit (QIAGEN GmbH, Hilden, Germany), denaturated, and a second fusion-PCR was performed with fragment A and B using primer P1 and P4. The resulting product contained primer sites of P1 and P4 and a deletion between fragment A and B of approximately 50 bp. This product was amplified in a next PCR and quantified after agarose gel electrophoresis and visualized by ethidium bromide staining and densitometric analyses (Molecular Analyst; Bio-Rad, Munich, Germany) using a Bluescript plasmid (pBR32) as a DNA quantification marker. A regression analysis was performed to quantify the competitor cDNA. Different dilutions of the competitor were used in the competitive PCR together with different dilutions of the wild-type cDNA. Primer for NCAM. cDNA of NCAM (GenBank accession no. X15049) (Barthels et al., 1987) was a kind gift of Dr. Christo Goridis (Institute de Biologie du Development de Marseille, Marseille, France). The primer-flanking sequences cover exons 2 to 9 and react with all known NCAM splice forms: P1–P4, 622 bp; P3–P4, 518 bp (deletion of 104 bp); P1, TGAGGGTACTTACCGCTGTG; P2, GGATCCGTTCACAAGCTCGTCCCATCAGCATCACACACCAG; P3, GACGAGCTTGTGAACGGATCCTCTGCATCGCAGAGAACAAG; and P4, GTTGCTGGCAGTGCACATGT. Mouse glyceraldehyde 3-phosphate dehydrogenase primer: GenBank accession no. M32599 (Sabath et al., 1990): P1–P2, 133 bp; P3–P4, 255 bp (deletion of 122 bp); P1, TGGTGAAGGTCGGTGTGAAC; P2, GGATCCGTTCACAACTGAGGTCAATGAAGGGGTCG; P3, GTTGTGAACGGATCCACCATCTTCCAGGAGCGAGA; and P4, GTGCAGGATGCATTGCTGAC. Primer for ST8SiaIV (PST), accession no. Y09486 (Takashima et al., 1998). cDNA was a kind gift from Prof. R. Gerardi Schahn (Medizinsche Hochschule Hannover, Hannover, Germany). P1, ACCGCAGGTTTAAGACCTGTGC; P2, GGATCCGTTCACAAGCTCGTCCACATCAGCAGCGAACTCCA; P3, GACGAGCTTGTGAACGGATCCTCCTGCCTTCATGGTCAAAG; and P4, GCCAGTATCCTCTGACTGCATG. RT-Competitive PCR. Reverse transcription (RT) of 0.1 g of total RNA using oligo(dT)15 was performed for 120 min at 42°C with 2 units of Superscript II reverse transcriptase (Invitrogen) in Superscript buffer (50 mM Tris, pH 8.3, 75 mM KCl, 3 mM MgCl2, 20 mM DTT, and 0.2 mM each of dATP, dGTP, dCTP, and dTTP). The samples were then heated for 1 min at 99°C to terminate the reverse transcription reaction. The polymerase chain reaction was performed on 1 l of a 1:10 dilution in water of a prepared cDNA. Then, 8 aliquots of the mixture was transferred to microtubes containing a different, but known, amount of competitor. After 120 s at 95°C, the Fig. 1. A, structure of VPA and VPA derivatives and their teratogenic potency in vivo; indicates the teratogenic potency in comparison with VPA as standard substance. B, gene expression of NCAM in F9 cells after treatment with different VPA derivatives. NCAM and GAPDH mRNA expression were measured by competitive RT-PCR as described under Materials and Methods. F9 cells were treated for 48 h with 1 mM 2-enVPA, 1 mM VPA, and a 0.25 mM concentration of one of the following: (S)-4-yn-VPA, (R)-4-yn-VPA, butyl-4-yn-VPA, pentyl-4-yn-VPA, hexyl-4yn-VPA, heptyl-4-yn-VPA, or 50 nM TSA. The analysis of the competitive RT-PCR is shown here. Values represent means S.D. from triple determinations, with asterisks indicating a significant difference (p 0.005; ANOVA) from untreated cultures. PPAR Alteration on Expression of NCAM and PST1 in F9 Cells 195 at A PE T Jornals on D ecem er 9, 2017 m oharm .aspeurnals.org D ow nladed from tubes were subjected to 30 cycles (60 s at 95°C, 60 s at 57°C, and 60 s at 72°C) of amplification and to a fill up step of 10 min at 72°C (MWG-Biotech, Ebersberg, Germany). Analysis of the PCR Products. The PCR products on the ethidium-stained agarose gel were analyzed densitometrically with the Molecular Analysis software (Bio-Rad). The amount of PCR product was calculated by integration of the peak area using the Molecular Analysis software. To determine the concentration of the target cDNA, the logarithm of the peak surface ratio of competitor-to-target cDNA was plotted against the logarithm of the amount of competitor added to the PCR medium. The initial concentration of the target cDNA in the reaction was determined at the competition equivalence point as described by Auboeuf et al. (1997). The absence of genomic DNA amplification during the RT-competitive PCR assay was verified by performing the reactions without the reverse transcriptase in the RT step. The relative amount of mRNA expression in comparison with mouse GAPDH is shown in the figures. Fig. 2. Protein expression of NCAM in F9 cells after treatment with different VPA derivatives. F9 cells were treated 48 h with 1 mM 2-en-VPA, 1 mM VPA, and a 0.25 mM concentration of one of the following: (S)-4-yn-VPA, (R)-4-yn-VPA, butyl-4-yn-VPA, pentyl-4-yn-VPA, hexyl-4-yn-VPA, heptyl4-yn-VPA, 50 nM TSA, or 5 M cPGI. NCAM protein level was measured by FACS analysis. A, typical result of an experiment. B, structure-activity relationships. Values represent means S.D. from four determinations, with asterisks indicating a significant difference (p 0.01; ANOVA) from untreated cultures. 196 Lampen et al. at A PE T Jornals on D ecem er 9, 2017 m oharm .aspeurnals.org D ow nladed from Validation of the RT-PCR Assay. To validate the RT-competitive PCR assay, RNAs corresponding to a part of mouse NCAM, PST1, or GAPDH were synthesized by in vitro transcription (Riboprobe system; Promega, Heidelberg, Germany) using plasmids containing the respective cDNA. Known amounts of these RNAs were quantified by RT-competitive PCR over a wide range of concentrations (0.25–50 amol) added to the RT medium. Standard curves were obtained. The linearity (with r between 0.98 and 1.00 for the different dose responses) and the slopes of the standard curves demonstrated that the RT-competitive assay developed in this work is indeed quantitative. The interassay variation of the RT-competitive PCR was estimated from at least eight separate determinations and found to be 3.8% when a small amount of target RNA was quantified (0.61 0.04 amol) and 11% with a higher amount (13.2 1.7 amol). Semiquantitative RT-PCR. A well established semiquantitative RT-PCR method was used for the measurement of the mRNA expression of NCAM in F9 cells as described in Lampen et al. (2001c). The primers for NCAM were 5 -TGAGGGTACTTACCGCTGTG-3 and 5 -GTTGCTGGCAGTGCACATGT-3 , with a product size of 622 bp. Primers for -actin were GGCGGCACCACCATGTACCCT for sense and AGGGGCCGGACTCGTCATACT for antisense (GenBank accession no. Mm 001101). Flow Cytometry (FACS Analysis). F9 cells were treated 2 days with or without VPA derivatives. Afterward, cells were separated from culture bottles with acutase (Biochrom, Berlin, Germany), and 250,000 cells in 100 l were added in each microplate well of a 96-well plate. After centrifugation (1000 U/min for 5 min), one of the following was added to each well: the first antibody H28 mouse -anti-NCAM (3.5 mg/ml) at a dilution of 1:50 (25 l/well) or 735 m-anti-PSA (8.18 mg/ml) at a dilution of 1:50. After incubation for 20 min at 4°C, the wells were washed three times with MIF (PBS with 2.5% bovine serum albumin) buffer. The second antibody was either a fluorescein isothiocyanate-labeled anti-rat (for H28 NCAM) at a dilution of 1:10 or anti-mouse (for 735 PSA) at a dilution of 1:20. One of these antibodies was added to each well and incubated for another 20 min at 4°C. Finally, 100 l of MIF buffer and the pellet was resuspended in a conical tube. After the addition of 100 l of PBS buffer and 200 l of PBS buffer containing 2 g/ml propidium iodide, the probes were measured in a FACScan (BD Biosciences, Heidelberg, Germany). The propidium iodide-stained (dead) cells were excluded from the analysis. H28 mouse Anti-NCAM and 735 m-antiPSA (Muhlenhoff et al., 1998) were a generous gift of Prof. R. Gerardy-Schahn (Medizinische Hochschule Hannover, Germany). Statistics. Values for concentrations and concentration ratios were expressed as means S.D. Statistical analysis for comparison of two means was performed using analysis of variance (ANOVA). Remarks. We investigated 13 antiepileptic VPA derivatives with almost comparable antiepileptic potency but different toxic effects, eight known teratogenic and five known nonteratogenic VPA derivatives (Fig. 1A). The teratogenic derivatives were (S)-4-yn-VPA, (R,S)-4-yn-VPA, 4-en-VPA, and four teratogens with increasing C chain length: butyl-4-yn-VPA, pentyl-4-yn-VPA, hexyl-4-yn-VPA, and heptyl-4-yn-VPA. The nonteratogenic derivatives were isobutyl4-yn-VPA, isobutyl-ethyl-4-yn-VPA, ethyl-4-yn-VPA, E-2-en-VPA, and 5 methy-4-yn-VPA (Hauck and Nau, 1992).